3.1 Describe the basic structure (double helix, sugar/phosphate backbone, linked by complementary nucleotide pairs) of DNA, and describe its function in genetic inheritance.
DNA: Deoxyribonucleic Acid
* Is located in the nucleus of every cell
* made up of 4 base pairs: Adenine A, Thymine T, Guanine G, and Cytosine C
A goes with T and G goes with C
*DNA is a chemical code of information, like a computer is 1's and 0's, 3.5 billion years ago nature wrote code using two chemical combinations AT and GC! You're blown away now.
* Our DNA has about 20,000 genes one it, but that is only 1% of the DNA strand. Scientists do not fully know what the other 99% of the DNA is all about
There are about 4 billion base pairs in one DNA molecule: Here are a few base pairings
AGCCCCGTTATCGCGCTAGCTCGTACGTCGCTCGATCAG
TCGGGGCAATAGCGCGATCGAGATGCAGCGAGCTAGTC